Journal: Nature Materials

Article Title: In vivo delivery of transcription factors with multifunctional oligonucleotides

doi: 10.1038/nmat4269

Figure Lengend Snippet: Figure 4 | DARTs are able to deliver Nrf2 to hepatocytes, upregulate Nrf2 downstream genes, and can protect hepatocytes against reactive oxygen species (ROS). a, Nrf2 delivered by DARTs enhances the expression of HO1, NQO1 and GCLC. RT–PCR shows that HepG2 cells treated with DART–Nrf2 have upregulated mRNA expression of HO1, NQO1 and GCLC. Free Nrf2 had no effect on HO1, NQO1 and GCLC gene expression. Raw gel scans are available in Supplementary Fig. 13. b, Nrf2 delivered by DARTs reduces ROS levels in HepG2 cells stressed with hydrogen peroxide. ROS levels in hydrogen-peroxide-stressed cells were not significantly reduced by free Nrf2, whereas DART–Nrf2 decreased ROS production down to levels comparable to control cells, mean ± s.e.m., n=9. ∗∗, p<0.01; NS, statistically not significant.

Article Snippet: HO1 antibody (sc-10789), NQO1 antibody (sc-25591) and bovine anti-rabbit IgG–HRP (sc-2370) were purchased from Santa Cruz Biotech.

Techniques: Expressing, Reverse Transcription Polymerase Chain Reaction, Gene Expression, Control

Journal: Nature Materials

Article Title: In vivo delivery of transcription factors with multifunctional oligonucleotides

doi: 10.1038/nmat4269

Figure Lengend Snippet: Figure 5 | The DARTs can deliver Nrf2 to the liver, upregulate Nrf2 downstream genes, and rescue mice from APAP-induced liver injury. a, Nrf2 delivered by DARTs rescues mice from APAP-induced liver injury. DART–Nrf2 complexes reduce serum ALT levels in APAP-treated mice by a factor of 4. Free Nrf2 had no effect. Nrf2 complexed with either Glu–DARTs or Gal–DNA, and free DARTs, did not cause a statistically significant reduction in ALT levels. Mean ± s.e.m., n=10. ∗∗p<0.01; NS, statistically not significantly different from APAP. b, Nrf2 delivered by DARTs reduces liver damage in APAP-treated mice. Histological sections of livers from APAP-treated mice showed that there was significant inflammation. In contrast, histological sections of livers from APAP mice treated with DART–Nrf2 had reduced liver damage and resembled the histological sections of healthy mice. Free Nrf2 was unable to suppress liver damage. Scale bars, 50 µm. c, Nrf2 delivered by DARTs enhances the expression of the proteins HO1 and NQO1 in the liver. APAP-treated mice were given either DART–Nrf2 or free Nrf2, and their livers were collected and western blot analysis was conducted for the proteins HO1, NQO1 and GAPDH. Mice treated with DART–Nrf2 complexes have increased HO1 and NQO1 expression in comparison with free-Nrf2- or APAP-treated mice. Control, no treatment; APAP, APAP alone; Nrf2, APAP + Nrf2; DART–Nrf2, APAP + DART–Nrf2. Raw gel scans are available in Supplementary Fig. 14.

Article Snippet: HO1 antibody (sc-10789), NQO1 antibody (sc-25591) and bovine anti-rabbit IgG–HRP (sc-2370) were purchased from Santa Cruz Biotech.

Techniques: Expressing, Western Blot, Comparison, Control

Journal: Gastric Cancer

Article Title: Insulin and the insulin receptor collaborate to promote human gastric cancer

doi: 10.1007/s10120-021-01236-y

Figure Lengend Snippet: Expression of genes that encode, and inhibition of, the insulin and type I IGF receptors in gastric adenocarcinoma. a The affinities of insulin, IGF-1 and IGF-2 for the insulin and type I IGF receptors are shown (adapted from ). Original references are included in the electronic supplementary material (Online Resource 1). Copy number and relative high expression of > 2 SD from the mean for diploid tumours of the genes that encode the insulin receptor ( INSR ) and type I IGF receptor ( IGF1R ) were analysed for 478 gastric adenocarcinomas [ , ]. b Log 2 transformed mRNA relative abundance deduced from absolute transcript abundance by RNA-Seq expectation maximization (RSEM) is shown against the putative copy-number alterations deduced from genomic sequencing data analysed with GISTIC 2.0. Horizontal bars represent the median values, boxes the range of the second and third quartiles of the data and whiskers the range of all data. Expression of INSR and IGF1R , is associated with CNV (Kruskal Wallis; p < 0.0001); statistically significant differences between groups are indicated (Dunn-Boniferroni post hoc; * p < 0.05 ( INSR ); * p < 0.005 ( IGF1R ); ** p < 0.0001 (either)). c Kaplan and Meier curves illustrate correlations analysed by the log rank test between INSR and IGF1R expression, and overall survival for 876 gastric cancer patients . d Kaplan and Meier curves illustrate correlation analysed by the log rank test between INSR expression, and overall survival for 392 gastric cancer patients . e INSR and IGF1R expression calculated as transcripts per million (tpm) in normal ( n = 34) and primary gastric tumour (1° tum.; n = 415) tissue (Student’s t -test; p < 0.0001 and p = 0.06, respectively) and methylation status upstream of INSR and IGF1R transcription start sites (Student’s t -test; p < 0.0002 and p = 0.195, respectively). f MCF-7 breast cancer cells (Br. Ca.), NCI-N87, KATO III, SNU-16, SNU-5, SNU-1, MKN74, NUGC3 and AGS gastric adenocarcinoma cells (Ga. Ad.) and metastatic cells isolated from gastric adenocarcinoma patients, GC1, HC1, NC1 and JW1, were lysed and insulin receptor, type I IGF receptor, β-tubulin or GAPDH were analysed by western transfer. ERBB2 , FGFR2 and MET are amplified and overexpressed in NCI-N87, KATO III and SNU-16, and SNU-5, respectively. SNU-1, MKN74, NUGC3 and AGS and the metastatic patient cells are triple-negative for amplification or overexpression of these oncogenes . g NCI-N87, SNU-16, SNU-5, SNU-1, MKN-74, NUGC3 and AGS were incubated in full, untreated FCS-containing medium without and with 0.5 µM BMS-754807 for three days, lysed and their DNA content measured. Asterisks indicate if there was significantly less DNA in the presence of BMS-754807 than in its absence (Student’s t -test; p < 0.01). h SNU-1, MKN-74, NUGC3 and AGS were incubated in untreated FCS-containing medium and different concentrations of BMS-754807 for three days or as indicated and their DNA content measured. The relative IC values are indicated by blue lines. Asterisks indicate times at which there was significantly less DNA in the presence of BMS-754807 than in its absence (one-way ANOVA; p < 0.0001)

Article Snippet: Cells were lysed in radioimmunoprecipitate (RIPA) buffer and analysed by western transfer as described [ ] with antibodies against: insulin receptor (#3025), type I IGF receptor (#3027), β-tubulin (#5346), phosphorylated Tyr 1150/1151 insulin and Tyr 1135/1136 type I IGF receptors (#3024), Akt (#9272), phosphorylated Ser 473 Akt (#4060), ERK1 and ERK2 (#9102), phosphorylated Thr 202/204 ERK1 and Thr 185/187 ERK2 (#4370), cleaved Asp 214 poly-(ADP-ribose) polymerase-1 (PARP-1) (#9541) (Cell Signaling Technologies), or GAPDH-HRP (sc-25778) (Santa Cruz Biotechnology).

Techniques: Expressing, Inhibition, Transformation Assay, RNA Sequencing, Genomic Sequencing, Methylation, Isolation, Western Blot, Amplification, Over Expression, Incubation

Journal: Gastric Cancer

Article Title: Insulin and the insulin receptor collaborate to promote human gastric cancer

doi: 10.1007/s10120-021-01236-y

Figure Lengend Snippet: Pharmacological inhibition of the insulin and type I receptors induces cell death a SNU-1 were cultured in suspension, whereas MKN74 and NUGC3 were plated onto coverslips, in untreated FCS-containing medium and the indicated concentration of BMS-754807 for three days. Cells were assayed for histone H3 Ser 10 phosphorylation (khaki arrows) by immunofluorescence and counterstained with DAPI. Asterisks indicate that the proportion of cells in the mitotic-phase of the cell cycle is significantly lower after incubation with BMS-754807 (one-way ANOVA; SNU-1, p = 0.0009; MKN74, p = 0.0046; NUGC3, p = 0.0023). NS indicates data that are not significantly different. Pale pink arrows indicate apoptotic cells. b SNU-1 were incubated in untreated FCS-containing with BMS-754807 (BMS) for three or six days. Cleaved caspase-3 or cleaved PARP were analysed by immunofluorescence (pink arrows). Asterisks indicate that the proportion of cells with detectable cleaved PARP is statistically significantly different after incubation with BMS-754807 (one-way ANOVA; p < 0.01). c Metastatic adenocarcinoma cells were isolated from patients and incubated in 20% untreated FCS-containing medium and different concentrations of BMS-754807 for three days after which cleaved PARP and GAPDH were analysed by western transfer. The protein bands were quantified by densitometry and corrected for GAPDH. Asterisks indicate concentrations of BMS-754807 at which there was statistically significantly more cleaved PARP in its presence than in its absence (one-way ANOVA; p < 0.001). d Cells were incubated in full, untreated FCS-containing medium with BMS-754807 for three days and phosphorylated (Phospho.) insulin Tyr 1150/1151 and type I IGF Tyr 1135/1136 receptors (IGF receptors), Akt Ser 473 and cleaved PARP analysed as above, quantified and corrected for corresponding total protein or GAPDH, respectively. Representative images are shown as inserts. Asterisks indicate concentrations of BMS-754807 at which there was statistically significantly less phosphorylated protein, or more cleaved PARP than in its absence (one-way ANOVA; p < 0.001). e SNU-1 and NUGC3 were incubated in serum-free medium for two hours and then in serum-free medium and the indicated concentrations of BMS-754807 in the absence or presence of ligand (lig.) for 15 min. Phosphorylated (Phospho.) insulin Tyr 1150/1151 and type I IGF Tyr 1135/1136 receptors (IGF receptors), Akt Ser 473 or GAPDH were measured. Total corresponding protein is shown underneath the phosphorylated protein images

Article Snippet: Cells were lysed in radioimmunoprecipitate (RIPA) buffer and analysed by western transfer as described [ ] with antibodies against: insulin receptor (#3025), type I IGF receptor (#3027), β-tubulin (#5346), phosphorylated Tyr 1150/1151 insulin and Tyr 1135/1136 type I IGF receptors (#3024), Akt (#9272), phosphorylated Ser 473 Akt (#4060), ERK1 and ERK2 (#9102), phosphorylated Thr 202/204 ERK1 and Thr 185/187 ERK2 (#4370), cleaved Asp 214 poly-(ADP-ribose) polymerase-1 (PARP-1) (#9541) (Cell Signaling Technologies), or GAPDH-HRP (sc-25778) (Santa Cruz Biotechnology).

Techniques: Inhibition, Cell Culture, Suspension, Concentration Assay, Phospho-proteomics, Immunofluorescence, Incubation, Isolation, Western Blot

Journal: Gastric Cancer

Article Title: Insulin and the insulin receptor collaborate to promote human gastric cancer

doi: 10.1007/s10120-021-01236-y

Figure Lengend Snippet: Cell survival effects of insulin, IGF-1 and IGF-2 in gastric adenocarcinoma. a NUGC3 were incubated in the absence or presence of 0.5 µM staurosporine without or with 50 ngml −1 ligand for 4 h, fixed and evidence of cell death analysed by immunofluorescent detection of cleaved Asp 214 PARP (pink arrows). The proportions of cells in which cell death had been induced are shown as means ± SEM (two-way ANOVA; p < 0.001). b Metastatic cells isolated from patients were added to poly-HEMA-coated wells in serum-free medium to prevent attachment and induce anoikis and incubated in serum-free medium in the absence or presence of ligand (lig.) minus or plus BMS-754807 for 24 h after which cleaved PARP, phosphorylated Akt Ser 473, Akt and GAPDH were measured by western transfer. Asterisks indicate if there was statistically significantly less cleaved PARP or more phosphorylated Ser 473 Akt after incubation in the presence of ligand, or more cleaved PARP or less phosphorylated Ser 473 Akt after incubation in the presence of ligand and BMS-754807, than in the presence of ligand alone (two-way ANOVA; p < 0.01). NS indicates data are not significantly different. c SNU-1 and NUGC3 were incubated with staurosporine and different concentrations of ligand prior to analysis of cleaved PARP, phosphorylated Akt Ser 473, Akt and GAPDH by western transfer. d The primary sequences of the insulin receptor in the second fibronectin type III domain (FnIII-2’) that differentiate isoform B from isoform A are shown (adapted from ). Insulin is shown positioned in the binding pocket of isoform B with the amino acid residues in FnIII-2’encoded by exon 11 that are absent in isoform A arrowed (adapted from ). The molecular masses of the IGF ligands and their affinities for insulin receptor isoforms B and A are listed . Please see electronic supplementary material for further details (online resource 1). e RNA extracted from gastric cancer cells and metastatic patient samples incubated in untreated FCS-containing medium was reverse transcribed and cDNA amplified with primers designed to detect insulin receptor isoform B (211 bp), insulin receptor isoform A (207 bp), isoform B and isoform A simultaneously (187 bp and 151 bp, respectively) or 18S rRNA (68 bp)

Article Snippet: Cells were lysed in radioimmunoprecipitate (RIPA) buffer and analysed by western transfer as described [ ] with antibodies against: insulin receptor (#3025), type I IGF receptor (#3027), β-tubulin (#5346), phosphorylated Tyr 1150/1151 insulin and Tyr 1135/1136 type I IGF receptors (#3024), Akt (#9272), phosphorylated Ser 473 Akt (#4060), ERK1 and ERK2 (#9102), phosphorylated Thr 202/204 ERK1 and Thr 185/187 ERK2 (#4370), cleaved Asp 214 poly-(ADP-ribose) polymerase-1 (PARP-1) (#9541) (Cell Signaling Technologies), or GAPDH-HRP (sc-25778) (Santa Cruz Biotechnology).

Techniques: Incubation, Isolation, Western Blot, Binding Assay, Reverse Transcription, Amplification

Journal: Gastric Cancer

Article Title: Insulin and the insulin receptor collaborate to promote human gastric cancer

doi: 10.1007/s10120-021-01236-y

Figure Lengend Snippet: Knockdown of the insulin receptor induces cell death in gastric cancer cells. a NUGC3 were transfected with scrambled oligonucleotide (scr.), siINSR2 or siIGF1R2 and analysed as described in the legend to Fig. . High magnification images facilitate visualisation of apoptotic nuclei (pale pink arrows). Cells were analysed next for the presence of cleaved PARP (pink arrows). Asterisks indicate that the proportion of apoptotic cells, or cells with cleaved PARP, is significantly higher after transfection with siINSR2 than with the scrambled oligonucleotide (**) or siIGF1R2 (*) (one-way ANOVA; p < 0.0001). NS indicates data are not significantly different. b SNU-1, MKN-74 and NUGC3 cells were transfected with scrambled oligonucleotide (scr.) or siINSR2 (siR) and cultured as indicated in untreated-FCS-containing medium prior to analysis of insulin receptor, cleaved PARP or GAPDH by western transfer. c SNU-1 and NUGC3 were transfected with scrambled oligonucleotide, siINSR2 or siINSR3 and cultured for three days in untreated-FCS-containing medium prior to measurement of insulin receptor, cleaved PARP or β-tubulin by western transfer. Asterisks (**) indicate that there was significantly less insulin receptor or more cleaved PARP after transfection with siINSR2 or siINSR3 than with scrambled oligonucleotide (one-way ANOVA; p < 0.001). d SNU-1, MKN-74, NUGC3 and AGS, and patient samples, HC1 and NC1, were transfected with scrambled oligonucleotide (scr.) or siIGF1R2, cultured for three days in untreated-FCS-containing medium and type I IGF receptor, cleaved PARP and GAPDH analysed. e NUGC3 were transfected with scrambled oligonucleotide (scr.), siINSR2, siIGF1R2 or both siINSR2 and siIGF1R2 and cultured in untreated-FCS-containing medium for three days prior to measurement of type I IGF receptor, insulin receptor, cleaved PARP or GAPDH by western transfer. There was significantly more cleaved PARP after transfection with siINSR2, or siINSR2 and siIGF1R2 (one-way ANOVA; p < 0.001)

Article Snippet: Cells were lysed in radioimmunoprecipitate (RIPA) buffer and analysed by western transfer as described [ ] with antibodies against: insulin receptor (#3025), type I IGF receptor (#3027), β-tubulin (#5346), phosphorylated Tyr 1150/1151 insulin and Tyr 1135/1136 type I IGF receptors (#3024), Akt (#9272), phosphorylated Ser 473 Akt (#4060), ERK1 and ERK2 (#9102), phosphorylated Thr 202/204 ERK1 and Thr 185/187 ERK2 (#4370), cleaved Asp 214 poly-(ADP-ribose) polymerase-1 (PARP-1) (#9541) (Cell Signaling Technologies), or GAPDH-HRP (sc-25778) (Santa Cruz Biotechnology).

Techniques: Knockdown, Transfection, Cell Culture, Western Blot

Journal: Cell reports

Article Title: FMR1 Reactivating Treatments in Fragile X iPSC-Derived Neural Progenitors In Vitro and In Vivo.

doi: 10.1016/j.celrep.2019.02.026

Figure Lengend Snippet: Figure 1. Screening for FMR1-Reactivating Compounds (A) RT-PCR analysis of FMR1 transcript levels in FXS-iPSCs B#40 following 96-h treatment with the nucleoside DNMT inhibitors, as compared to WT-ESCs: 5-azacytidine (5-azaC) (5 mM); 5-aza-2-deoxycytidine (5-azadC) (5 mM); SGI-110 (guadecitabine; 2 mM); zebularine (100 mM); and the non-nucleoside DNMT inhibitors: procainamide (100 mM); hydralazine (100 mM); SGI-1027 (5 mM); mythramycin A (MMA) (10 mM); and RG108 (20 mM). (B) FMR1 reactivation screening workflow. FXS-iPSCs A#52 were seeded in 96-well plates. A total of 140 epigenetic modifiers were screened at two concen- trations (2 mM and 20 mM) and three replicates. After 72-h incubation, the cells were immunostained for FMRP. Automated image acquisition and analysis were used to assess the percent of FMRP-expressing cells. (C) Immunostaining of FMRP (red) in WT-ESCs and FXS-iPSCs A#52. Nuclear staining is in blue (DAPI). (D) Detection of FMRP expression in different ratios of WT and FXS-iPSC culture. FXS-iPSCs and WT-ESCs were mixed at different ratios and seeded in a 96-well plate. Immunostaining was performed following 24-h incubation. Automated image acquisition and analysis were used to detect the fraction of FMRP-expressing cells. (E) Average fraction of FMRP-positive cells following different incubation times with 5-aza-2-deoxycytidine (1 mM), relative to WT-ESCs. Each well was evaluated for the number of FMRP-expressing cells. (F) Scatterplot analysis (of a representative plate of 7 plates) of FMRP reactivation screen. Each compound was evaluated for cell survival following the treatment versus the fraction of FMRP-expressing cells. Some compounds (red square) were too toxic to assess using our system. Others (purple square) did not induce a significant FMRP signal. Compounds that induced FMRP expression (orange square) were further tested using RT-PCR. (G) RT-PCR analysis of FMR1 transcript levels following 7 days treatment of FXS-iPSCs A#52 and FXS-iPSCs C#2 with either DZNep (20 mM) or 5-azadC (1 mM). (H) DZNep potentiates the effect of demethylating treatment compared with DNMT inhibitors alone. Three FXS-iPSC cell lines were treated for 4 days with DMSO only, 5-azadC (100 nM) and DMSO, or 5-azadC and DZNep (25 mM). *p < 0.05; ***p < 0.001. Error bars represent SEM of at least three replicates. See also Figure S1 and Tables S1 and S2.

Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Mouse Monoclonal anti-FMRP Abfrontier Cat#YF-MA10356; RRID: AB_1505373 Rabbit Polyclonal anti-FMRP Abcam Cat#Ab17722; RRID: AB_2278530 Goat Polyclonal anti-FMRP Santa Cruz Biotechnology Cat#sc-10547; RRID: AB_2231879 Mouse Monoclonal anti-Mitochondria Millipore Cat#MAB1273; RRID: AB_94052 Goat Polyclonal anti-NCAM1 R&D Systems Cat# AF2408; RRID: AB_442152 Mouse Monoclonal anti-TUJ1 Millipore Cat#MAB1637; RRID: AB_2210524 Rabbit Monoclonal anti-GAPDH Cell Signaling Cat#2118; RRID: AB_561053 Mouse monoclonal anti-Nestin Millipore Cat# MAB353; RRID: AB_94911 Chemicals, Peptides, and Recombinant Proteins Epigenetics Screening Library (96-Well) Cayman Chemical Cat#11076 5-aza-20-Deoxycytidine Cayman Chemical Cat#11166 3-Deazaneplanocin A Cayman Chemical Cat#13828 SB431542 Biogems Cat# 3014193 LDN-193189 Biogems Cat#1066208 Dorsomorphin Tocris Bioscience Cat# 3093 N2 Supplement Invitrogen Cat# 17502048 Critical Commercial Assays NucleoSpin RNA Plus kit Macherey-Nagel Cat# 740984 AmplideX FMR1 PCR kit Asuragen Cat# 76008 Deposited Data Raw and Deposited Data This paper GEO: GSE112145 Experimental Models: Cell Lines FXS-iPSCs A#52 Urbach et al., 2010 N/A FXS-iPSCs A#55 Urbach et al., 2010 N/A FXS-iPSCs C#2 Urbach et al., 2010 N/A FXS-iPSCs B#40 Urbach et al., 2010 N/A Fipco-3 (edited FXS-iPSCs) Park et al., 2015 N/A Experimental Models: Organisms/Strains Mouse: NOD-scid IL2Rgnull Jackson Laboratories N/A Mouse: C57BL/6 Harlan N/A Oligonucleotides Primer FMR1 Forward: GCAGCATGTGATGCAACTTACA This paper N/A Primer FMR1 Reverse: CGCCTCTTTGGCACACATT This paper N/A Primer GAPDH Forward: AGCCACATCGCTCAGACACC This paper N/A Primer GAPDH Reverse: GTACTCAGCGCCAGCATCG This paper N/A Primer DNMT1 Forward: GATCCCAGTCCCGAGTATGC This paper N/A Primer DNMT1 Reverse: GAGGCCAGAAGGAGGAACCG This paper N/A DNMT1 sgRNA sequence: GAGGCCAGAAGGAGGAACCG This paper N/A Recombinant DNA lentiCRISPR v2 Feng Zhang lab Addgene plasmid #52961 pCMV-VSV-G B. Weinberg Addgene plasmid #8454 psPAX2 D. Trono Addgene plasmid #12260 (Continued on next page) e1 Cell Reports 26, 2531–2539.e1–e4, March 5, 2019

Techniques: Reverse Transcription Polymerase Chain Reaction, Incubation, Expressing, Immunostaining, Staining

Journal: Cell reports

Article Title: FMR1 Reactivating Treatments in Fragile X iPSC-Derived Neural Progenitors In Vitro and In Vivo.

doi: 10.1016/j.celrep.2019.02.026

Figure Lengend Snippet: Figure 3. Demethylating Treatment of Humanized Mice Carrying FXS Transplants (A) Schematic representation of in vivo experiment. Undifferentiated FXS-iPSCs were injected subcutaneously into NOD-SCID Il2rg/ immunodeficient mice. 6 weeks following the injection, the mice received 5 intraperitoneal injections of 5-azadC in a dosage of 5–15 mg/kg/day. FXS transplants were extracted 0, 3, 6, 14, and 30 days following the treatment (n = 3 for each time point). (B) RT-PCR analysis of FMR1 mRNA expression in differentiated FXS-C#2 iPSC-derived transplants in NOD-SCID Il2rg/ mice 1, 3, 6, 14, and 30 days following systemic treatment with 5-azadC, normalized relative to WT transplants. (C) Pyrosequencing analysis of DNA methylation of the FMR1 promoter (in 17 CpG positions) following 5 days of systemic 5-azadC treatment in FXS-affected transplants, derived from two FXS-iPSC lines (A#52 and C#2). AZA high = 15 mg/kg/day. AZA low = 5 mg/kg/day. (D) Immunohistochemical staining (3,30-diaminobenzidine) for FMRP in untreated and 5-azadC-treated FXS transplanted. Serial sectioning of FXS transplants revealed that FMRP expression was confined to primitive neural structures, identified by their rosette-like structure of radial and multilayered arrangement of epithelial cells (dashed line). (E) RT-PCR analysis of FMR1 expression in FXS-transplant-derived cell lines. 5-azadC-treated FXS transplants were dissociated and plated on tissue culture plates and treated with either DMSO or DZNep (25 mM) for 4 days. The values are normalized relative to FXS-affected cells. (F) RT-PCR analysis of FMR1 expression in FXS transplants treated by either a combination of DZNep (20 mg/kg/day) and 5-azadC (5 mg/kg/day) or by 5-azadC alone for 5 days. The values are normalized relative to FXS-affected cells. (G) Pyrosequencing analysis of DNA methylation in the FMR1 promoter (in 17 CpG positions) in FXS transplants following treatment by either a combination of DZNep (20 mg/kg/day) and 5-azadC (5 mg/kg/day) or by 5-azadC alone for 5 days. *p < 0.05; ***p < 0.001. Statistical tests were performed with three independent experiments. Error bars represent SEM. See also Figure S3.

Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Mouse Monoclonal anti-FMRP Abfrontier Cat#YF-MA10356; RRID: AB_1505373 Rabbit Polyclonal anti-FMRP Abcam Cat#Ab17722; RRID: AB_2278530 Goat Polyclonal anti-FMRP Santa Cruz Biotechnology Cat#sc-10547; RRID: AB_2231879 Mouse Monoclonal anti-Mitochondria Millipore Cat#MAB1273; RRID: AB_94052 Goat Polyclonal anti-NCAM1 R&D Systems Cat# AF2408; RRID: AB_442152 Mouse Monoclonal anti-TUJ1 Millipore Cat#MAB1637; RRID: AB_2210524 Rabbit Monoclonal anti-GAPDH Cell Signaling Cat#2118; RRID: AB_561053 Mouse monoclonal anti-Nestin Millipore Cat# MAB353; RRID: AB_94911 Chemicals, Peptides, and Recombinant Proteins Epigenetics Screening Library (96-Well) Cayman Chemical Cat#11076 5-aza-20-Deoxycytidine Cayman Chemical Cat#11166 3-Deazaneplanocin A Cayman Chemical Cat#13828 SB431542 Biogems Cat# 3014193 LDN-193189 Biogems Cat#1066208 Dorsomorphin Tocris Bioscience Cat# 3093 N2 Supplement Invitrogen Cat# 17502048 Critical Commercial Assays NucleoSpin RNA Plus kit Macherey-Nagel Cat# 740984 AmplideX FMR1 PCR kit Asuragen Cat# 76008 Deposited Data Raw and Deposited Data This paper GEO: GSE112145 Experimental Models: Cell Lines FXS-iPSCs A#52 Urbach et al., 2010 N/A FXS-iPSCs A#55 Urbach et al., 2010 N/A FXS-iPSCs C#2 Urbach et al., 2010 N/A FXS-iPSCs B#40 Urbach et al., 2010 N/A Fipco-3 (edited FXS-iPSCs) Park et al., 2015 N/A Experimental Models: Organisms/Strains Mouse: NOD-scid IL2Rgnull Jackson Laboratories N/A Mouse: C57BL/6 Harlan N/A Oligonucleotides Primer FMR1 Forward: GCAGCATGTGATGCAACTTACA This paper N/A Primer FMR1 Reverse: CGCCTCTTTGGCACACATT This paper N/A Primer GAPDH Forward: AGCCACATCGCTCAGACACC This paper N/A Primer GAPDH Reverse: GTACTCAGCGCCAGCATCG This paper N/A Primer DNMT1 Forward: GATCCCAGTCCCGAGTATGC This paper N/A Primer DNMT1 Reverse: GAGGCCAGAAGGAGGAACCG This paper N/A DNMT1 sgRNA sequence: GAGGCCAGAAGGAGGAACCG This paper N/A Recombinant DNA lentiCRISPR v2 Feng Zhang lab Addgene plasmid #52961 pCMV-VSV-G B. Weinberg Addgene plasmid #8454 psPAX2 D. Trono Addgene plasmid #12260 (Continued on next page) e1 Cell Reports 26, 2531–2539.e1–e4, March 5, 2019

Techniques: In Vivo, Injection, Reverse Transcription Polymerase Chain Reaction, Expressing, Derivative Assay, DNA Methylation Assay, Immunohistochemical staining, Staining

Journal: Cell reports

Article Title: FMR1 Reactivating Treatments in Fragile X iPSC-Derived Neural Progenitors In Vitro and In Vivo.

doi: 10.1016/j.celrep.2019.02.026

Figure Lengend Snippet: Figure 4. FMR1 Reactivation of Human FXS-NPCs Transplanted in Murine Brains (A) Detection of human neural precursor cells (NPCs) within murine brains. 12 days after human NPCs injection, murine brains were dissected and stained for human-specific anti-mitochondria antibody (red). Human NPC grafts were detected upon injection into the lateral ventricles (left) and hippocampus (right). (B) Immunofluorescent staining of FXS-NPCs grafts using anti-Nestin antibody. (C) RT-PCR analysis of FMR1 mRNA expression in 5-azadC-treated FXS-NPC grafts. FMR1 expression was assessed using human-specific FMR1 primers. (D and E) Immunofluorescent staining of human FXS-NPC grafts within murine brains. WT-NPCs, untreated FXS-NPCs, and 5-azadC-treated FXS-NPCs were evaluated for FMRP expression 12 days following transplantation into the lateral ventricles (D) or hippocampus (E). Grafts were identified using human anti-mitochondria antibody (green), and FMRP expression was demonstrated using human-specific anti-FMRP antibody (red). FMRP expression was detected in 5-azadC-treated FXS grafts, but not in DMSO-treated FXS grafts. CA1, cornu ammonis 1; DG, dentate gyrus; LV, lateral ventricle. Scale bars: (A and B) 200 mm; (D–G) left, 200 mm; right, 20 mm. *p < 0.05; ***p < 0.001. Error bars represent SEM. See also Figure S4.

Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Mouse Monoclonal anti-FMRP Abfrontier Cat#YF-MA10356; RRID: AB_1505373 Rabbit Polyclonal anti-FMRP Abcam Cat#Ab17722; RRID: AB_2278530 Goat Polyclonal anti-FMRP Santa Cruz Biotechnology Cat#sc-10547; RRID: AB_2231879 Mouse Monoclonal anti-Mitochondria Millipore Cat#MAB1273; RRID: AB_94052 Goat Polyclonal anti-NCAM1 R&D Systems Cat# AF2408; RRID: AB_442152 Mouse Monoclonal anti-TUJ1 Millipore Cat#MAB1637; RRID: AB_2210524 Rabbit Monoclonal anti-GAPDH Cell Signaling Cat#2118; RRID: AB_561053 Mouse monoclonal anti-Nestin Millipore Cat# MAB353; RRID: AB_94911 Chemicals, Peptides, and Recombinant Proteins Epigenetics Screening Library (96-Well) Cayman Chemical Cat#11076 5-aza-20-Deoxycytidine Cayman Chemical Cat#11166 3-Deazaneplanocin A Cayman Chemical Cat#13828 SB431542 Biogems Cat# 3014193 LDN-193189 Biogems Cat#1066208 Dorsomorphin Tocris Bioscience Cat# 3093 N2 Supplement Invitrogen Cat# 17502048 Critical Commercial Assays NucleoSpin RNA Plus kit Macherey-Nagel Cat# 740984 AmplideX FMR1 PCR kit Asuragen Cat# 76008 Deposited Data Raw and Deposited Data This paper GEO: GSE112145 Experimental Models: Cell Lines FXS-iPSCs A#52 Urbach et al., 2010 N/A FXS-iPSCs A#55 Urbach et al., 2010 N/A FXS-iPSCs C#2 Urbach et al., 2010 N/A FXS-iPSCs B#40 Urbach et al., 2010 N/A Fipco-3 (edited FXS-iPSCs) Park et al., 2015 N/A Experimental Models: Organisms/Strains Mouse: NOD-scid IL2Rgnull Jackson Laboratories N/A Mouse: C57BL/6 Harlan N/A Oligonucleotides Primer FMR1 Forward: GCAGCATGTGATGCAACTTACA This paper N/A Primer FMR1 Reverse: CGCCTCTTTGGCACACATT This paper N/A Primer GAPDH Forward: AGCCACATCGCTCAGACACC This paper N/A Primer GAPDH Reverse: GTACTCAGCGCCAGCATCG This paper N/A Primer DNMT1 Forward: GATCCCAGTCCCGAGTATGC This paper N/A Primer DNMT1 Reverse: GAGGCCAGAAGGAGGAACCG This paper N/A DNMT1 sgRNA sequence: GAGGCCAGAAGGAGGAACCG This paper N/A Recombinant DNA lentiCRISPR v2 Feng Zhang lab Addgene plasmid #52961 pCMV-VSV-G B. Weinberg Addgene plasmid #8454 psPAX2 D. Trono Addgene plasmid #12260 (Continued on next page) e1 Cell Reports 26, 2531–2539.e1–e4, March 5, 2019

Techniques: Injection, Staining, Reverse Transcription Polymerase Chain Reaction, Expressing, Transplantation Assay

Journal: Cellular and Molecular Gastroenterology and Hepatology

Article Title: PYK2 Is Involved in Premalignant Acinar Cell Reprogramming and Pancreatic Ductal Adenocarcinoma Maintenance by Phosphorylating β-Catenin Y654

doi: 10.1016/j.jcmgh.2019.07.004

Figure Lengend Snippet: Gene transcription of PYK2 in PDAC cells is YAP/TAZ- and STAT3-dependent. ( A ) Left and middle : the whole-cell lysates from CFPAC-1 and AsPC-1 scrambled shRNA control cells or STAT3 shRNA knockdown cells were used for immunoblotting with indicated antibodies. Right : quantified immunoblotting data for PYK2 from 3 independent experiments are presented as means ± SD. ( B ) Upper : IHC staining of p-STAT3 Y705 was performed in pancreatic tissue sections from 6-week-old indicated mice injected with 1 set of PBS or cerulein for 2 consecutive days. The pancreatic tissues were collected 2 days after injection. Scale bars : 50 μm. Lower : IHC staining of p-STAT3 Y705 was performed in pancreatic tissue sections from 6-month-old indicated mice. Scale bars : 50 μm. Representative images from 3 independent experiments are shown. ( C ) Left and middle : Western blots were performed with indicated antibodies using the whole-cell lysates from CFPAC-1 and AsPC-1 scrambled shRNA control cells and YAP / TAZ double-knockdown cells. TAZ level was barely detected in AsPC-1 cells. Right : quantified immunoblotting data for PYK2 from 3 independent experiments are presented as means ± SD. ( D ) IHC staining of YAP was performed on consecutive sections described in panel B . Scale bars : 50 μm. Representative images from 3 independent experiments are shown. ( E ) pGL3 vector encompassing PYK2 promoter region (from -2063 bp to +113 bp) was co-transfected with pRL-TK into CFPAC-1 scrambled shRNA control cells or indicated shRNA knockdown cells. Forty-eight hours after transfection, the cells were collected for luciferase assays using the dual-luciferase reporter assay system. The data are presented as fold changes to shRNA control and are representative of 3 independent experiments. Values are means ± SD. ( F ) Co-expression of YAP , STAT3 , and PYK2 in PDAC cases from the TCGA database. P values were determined using a paired Student t test.

Article Snippet: To construct lentiviral-based vectors for TAZ knockdown, primers containing the sequence of shRNA oligonucleotides for TAZ (5’-CCAGGAACAAACGTTGACTTA-3’) were annealed and ligated into pLKO.1-blasticidin, which was obtained from Addgene.

Techniques: shRNA, Control, Knockdown, Western Blot, Immunohistochemistry, Injection, Plasmid Preparation, Transfection, Luciferase, Reporter Assay, Expressing

Journal: Cellular and Molecular Gastroenterology and Hepatology

Article Title: PYK2 Is Involved in Premalignant Acinar Cell Reprogramming and Pancreatic Ductal Adenocarcinoma Maintenance by Phosphorylating β-Catenin Y654

doi: 10.1016/j.jcmgh.2019.07.004

Figure Lengend Snippet: PYK2 activates the Wnt/β-catenin pathway through phosphorylating β-catenin Y654 . ( A ) Deletion of PYK2 affects ERK1/2 and RAS activity. Pancreatic tissue lysates from indicated mice (age, 4 mo) were used for immunoblotting with the indicated antibodies. To detect Guanosine-5’-triphosphate (GTP)-bound RAS, the lysates were incubated with rapidly accelerated fibrosarcoma (RAF) RAS binding domain (RBD) agarose. The bound proteins then were resolved by SDS-PAGE and blotted with anti-RAS antibody. Quantified immunoblotting data from 3 independent experiments are presented as means ± SD. ( B ) Messenger RNA (mRNA) from AsPC-1 scrambled shRNA control cells and PYK2 knockdown cells was isolated for quantitative reverse-transcription PCR. β-actin was used as an internal control. The data are presented as fold change to shRNA control in triplicate and are representative of 3 independent experiments. Values are means ± SD. ( C ) Lysates from scrambled shRNA control AsPC-1 cells and PYK2 knockdown cells were used for immunoblotting with the indicated antibodies. The representative result of 3 independent experiments is shown. ( D ) Recombinant β-catenin (100 ng) was incubated with purified PYK2 or FAK recombinant protein (or kinase buffer as a negative control) in the presence of adenosine triphosphate at 37°C for 1 hour. The reaction mixtures were subjected to immunoblotting analysis using the indicated antibodies. The representative result of 4 independent experiments is shown. ( E ) β-catenin localization was assessed in AsPC-1 scrambled shRNA cells and PYK2 knockdown cells using immunofluorescence staining. Scale bars : 50 μm. Representative images of 3 independent experiments are shown. ( F ) Cytoplasmic and nuclear fractions of scrambled shRNA control AsPC-1 cells and PYK2 knockdown cells were used for immunoblotting with the indicated antibodies. Quantified immunoblotting data from 3 independent experiments are presented as means ± SD. ( G ) Immunoblotting analysis was performed using pancreatic tissue lysates from 4-month-old Pdx-Cre mice and Pdx-Cre ; LSL-Kras G12D mice. Each lane represents a single mouse. ( H ) Six-week-old C57BL/6 mice were injected with cerulein or PBS for 2 consecutive days. The pancreatic tissues were collected 2 days after injection for immunoblotting analysis with the indicated antibodies. ( G and H ) Representative immunoblotting results from 3 independent experiments are shown. The numbers under each blot represent the band intensity normalized to β-actin and relative to expression of target proteins in Pdx-Cre mice or PBS-treated C57BL/6 mice. ( I ) IHC staining of β-catenin in pancreatic sections from indicated mice. Scale bars : 50 μm. ( J ) Six-week-old indicated mice were injected with cerulein or PBS for 2 consecutive days. The pancreatic tissues were collected 2 days after the last injection and processed for IHC staining with anti–β-catenin antibody. Scale bars : 50 μm. Representative images of 3 independent experiments are shown. ( K and L ) The whole-cell lysates from AsPC-1 scrambled shRNA control cells or cells with indicated gene knockdown were used for immunoprecipitation or immunoblotting with the indicated antibodies. Quantified immunoblotting data from 3 independent experiments are presented as means ± SD. DAPI, 4′,6-diamidino-2-phenylindole.

Article Snippet: To construct lentiviral-based vectors for TAZ knockdown, primers containing the sequence of shRNA oligonucleotides for TAZ (5’-CCAGGAACAAACGTTGACTTA-3’) were annealed and ligated into pLKO.1-blasticidin, which was obtained from Addgene.

Techniques: Activity Assay, Western Blot, Incubation, Binding Assay, SDS Page, shRNA, Control, Knockdown, Isolation, Reverse Transcription, Recombinant, Purification, Negative Control, Immunofluorescence, Staining, Injection, Expressing, Immunohistochemistry, Immunoprecipitation

Journal: Cellular and Molecular Gastroenterology and Hepatology

Article Title: PYK2 Is Involved in Premalignant Acinar Cell Reprogramming and Pancreatic Ductal Adenocarcinoma Maintenance by Phosphorylating β-Catenin Y654

doi: 10.1016/j.jcmgh.2019.07.004

Figure Lengend Snippet: PYK2 promotes PDAC cell proliferation and in vivo tumor growth by phosphorylating β-catenin Y654 . ( A and B ) Left : cell viability of the indicated cell lines was determined by cell counting kit-8 (CCK-8) assay. Data are presented as means ± SD from 3 independent experiments. *Statistically significant difference ( P < .05, Student t test) when compared with cells expressing PYK2 shRNA 1. Right : immunoblotting analysis of cell lines used in the cell viability assay with the indicated antibodies. ( C ) Indicated CFPAC-1 cells were injected into both flanks of nude mice (5 mice in each cell group). Tumor sizes were measured at the indicated time points. Tumor volumes were calculated and plotted. Values are means ± SD. *Statistically significant difference ( P < .05, Student t test) when compared with the PYK2 knockdown group. ( D ) Schematic diagram summarizing the YAP/TAZ/STAT3/PYK2/p–β-catenin Y654 axis in PDAC initiation.

Article Snippet: To construct lentiviral-based vectors for TAZ knockdown, primers containing the sequence of shRNA oligonucleotides for TAZ (5’-CCAGGAACAAACGTTGACTTA-3’) were annealed and ligated into pLKO.1-blasticidin, which was obtained from Addgene.

Techniques: In Vivo, Cell Counting, CCK-8 Assay, Expressing, shRNA, Western Blot, Viability Assay, Injection, Knockdown